Skip to content

Using Capfinder's Python API

If you need to integrate Capfinder directly into your Python scripts instead of using it via the terminal, you can utilize the Python API as follows:

Extract Cap Signal

from capfinder.cli import app

app(
    ["extract-cap-signal",
     "--bam_filepath", "/path/to/bam",
     "--pod5_dir", "/path/to/pod5",
     "--reference", "GCTTTCGTTCGTCTCCGGACTTATCGCACCACCTATCCATCATCAGTACTGT",
     "--cap_class", "1",
     "--cap_n1_pos0", "52",
     "--train_or_test", "test",
     "--output_dir", "/path/to/output"]
)

This example demonstrates how to use the Capfinder Python API to extract the signal corresponding to the RNA cap type from BAM and POD5 files. The extract-cap-signal command is invoked using the app.run() method, passing in the necessary parameters such as the paths to the BAM and POD5 files, the reference sequence, the cap class, the position of the cap N1 base, whether the data is for training or testing, and the output directory.

Prepare the Training Dataset

app(
    ["make-train-dataset",
     "--caps_data_dir", "/path/to/csv",
     "--output_dir", "/path/to/save",
     "--target_length", "500",
     "--dtype", "float16"]
)

This example shows how to use the Capfinder Python API to prepare the dataset for training the machine learning model. The make-train-dataset command is called, where you specify the directory containing the cap signal CSV files, the output directory to save the processed dataset, the target length for the input sequences, and the data type to use for the dataset. This command can be run independently or is automatically invoked by the train-model command.

Create a Training Configuration File

app(
    ["create-train-config",
     "--file_path", "/path/to/config.json"]
)

This example demonstrates how to use the Capfinder Python API to create a JSON configuration file for the training pipeline. The create-train-config command is called, and you provide the file path where the configuration file should be saved.

Train the Model

app(
    ["train-model",
     "--config_file", "/path/to/config.json"]
)

This example shows how to use the Capfinder Python API to train the model. The train-model command is called, and you provide the path to the JSON configuration file that contains the training parameters.

Predict Cap Types

app(
    ["predict-cap-types",
     "--bam_filepath", "/path/to/bam",
     "--pod5_dir", "/path/to/pod5",
     "--output_dir", "/path/to/output",
     "--n_cpus", "10",
     "--dtype", "float16",
     "--batch_size", "256",
     "--plot-signal",
     "--debug",
     "--refresh-cache"]
)

This example demonstrates how to use the Capfinder Python API to predict the RNA cap types. The predict-cap-types command is called, and you provide the paths to the BAM and POD5 files, the output directory, the number of CPUs to use, the data type to use for the model input, the batch size for inference, and options to control signal plotting, debugging, and cache refreshing.

Manage Cap Mappings

app(
    ["capmap", "add", "--cap_int", "7", "--cap_name", "new_cap_type"]
)

app(
    ["capmap", "remove", "--cap_int", "7"]
)

app(
    ["capmap", "list"]
)

app(
    ["capmap", "reset"]
)

app(
    ["capmap", "config"]
)

These examples show how to use the Capfinder Python API to manage the cap mappings. The capmap commands are used to add a new cap mapping, remove an existing cap mapping, list all current cap mappings, reset the cap mappings to the default, show the location of the cap mapping configuration file, and display the help information for cap mapping management.